Figure 1

PCR-fusion/Gateway procedure: 'gene fusion' protocol. (A) Schematic of gene fusion protocol. PCR amplification from entry clones (primer pairs F × SR and SF × R) of fragments with short overlapping ends; joining of the PCR fragments by single overlap extension; direct LR clonase II mediated cloning of the assembled DNA fragment into a binary destination vector and generation of binary expression vector (expression clone). The recombination of att L1 and L2 sites with att R1 and R2 sites to give att B sites flanking the fused DNA fragments during the Gateway cloning are designated. Cassette enables efficient selection of entry and expression clones and contains ccdB and chloramphenicol resistance (CmR) genes (indicated with ccd/CmR). (B) Generation of AtCesA7 (aa: 1-1007)/AtCesA8 (aa: 965-985) gene fusion. Two fragments were amplified from the starting entry clones with primers: clone pZ3 (AtCesA7): F(M13for)-gtaaaacgacggccagt × SR- ggagacgaaaggattaattcttacccaaag and clone pZ1(AtCesA8): SF-ctttgggtaagaattaatcctttcgtctcc × R(M13rev)-caggaaacagctatgac. Note that primers F and R are universal M13-forward and M13-reverse primers matching the vector sequence outside the att L1/att L2 region. The sequences of the overlapping ends of the two PCR fragments and gene fusion site are presented. The primer sequences are underline. The AtCesA8 sequences are in bold type. (C) Sequencing of the DNA fusion site in binary expression vector p3K3C1 which contained a AtCesA7 (aa: 1-1007)/AtCesA8 (aa: 965-985) fusion cloned into p3KC binary destination vector. The fusion site and position of SF primer are designated on the DNA sequence.