Skip to main content

Table 1 Sequences of oligonucleotides used for amplifying NbPDS inserts

From: Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus

Primer name Sequence (5'-3')
NbPDSfor1 CACCGTTCAGGGGTATCTTTTTGTGG
NbPDSfor2 CACCAGAATTCGTAGTCCCAGTGC
NbPDSfor3 CACCATGCAGAACCTGTTTGGAGAA
NbPDSfor4 CACCTTCATAAACCCTGACGAGCTTT
NbPDSfor5 CACCTGGGAGTTCCTGTGATAAATG
NbPDSfor6 CACCCCCTTGCAAAGATCCCCTA
NbPDSrev1 GTGTACAACGCTAATTCAGCG
NbPDSrev2 GTTAAGTGCCTTTGACATGGC
NbPDSrev3 GACTTTCTCGGGGCCACGTAAG
NbPDSrev4 AGCGGCTGAACTCCCCTGGCT
NbPDSrev5 TTCCTTCCACTGCAACCGATC
NbPDSrev6 AAACTTATGCCCCATGGAGTC
NbPDSrev7 ATTTGGGTAAGCCCCAAAGAAT
NbPDSrev8 CTAGCTTCTCCAACTTTTGGAA
NbPDSrev9 CCGACAGGGTTCACAACCTGG
NbPDSrev10 (TTT)8V
NbPDSrev11 (TTT)8GTTAAGTGCCTTTGAC
NbPDSrev12 (CCC)8GTTAAGTGCCTTTGAC
  1. 1 V represents A, C or G