Skip to main content

Table 1 Oligonucleotides used to generate epitope tags. Restriction sites are in bold and linker sequences are underlined.

From: A modified Gateway cloning strategy for overexpressing tagged proteins in plants

Oligo name Sequence 5'-3'
nSTREPfw TCGAC ATGTGGAGCCATCCGCAGTTCGAAAAAGGCGGCAGCGGCG
nSTREPrev GATCC GCCGCTGCCGCC TTTTTCGAACTGCGGATGGCTCCACATG
nHAfw GAAGTCGAC ATGTCGCGATACCCCTAC
nHArev GAAGGATCC TCCACTGCTAGC GGCGTAG
nMycfw GAGTCGAC GGTATCGATTTAAAGC
nMycrev GAAGGATCC CGGGCTTCCGGA ATTCAAGTCCTCTTC
nGSTfw GAAGTCGAC ATGTCCCCTATACTAGGTTATTG
nGSTrev ACGGGATCC ACGCGGAACCAG ATC
nYFPfw GGGTCGAC ATGGTGAGCAAGGGCG
nYFPrev CCGGATCC AGGCTTGTACAGCTCGTCCATG
cSTREPfw GGCCGC AAGCGGCGGA TGGAGCCATCCGCAGTTCGAAAAATAGC
cSTREPrev TCGAG CTATTTTTCGAACTGCGGATGGCTCCATCCGCCGCTTGC
cHAfw AGCGGCCGC AAGCGGAGGCCTGTCGCGA TAC
cHArev GAACTCGAG AGTACTGCTCTAGGCTTAGTCGGGCAC
cMycfw GAAGCGGCCGC ACAAGCT ATGGAGCAAAAGC
cMycrev GAACTCGAG TCAGGAATTCAAGTCCTC
cGSTfw AGCGGCCGC AAGCGGAGGC ATGTCCCCTATACTAGG
cGSTrev GAACTCGAG CTAATCCGATTTTGGAGGATGG
cYFPfw GGGCGGCCGC ACCTATGGTGAGCAAGGGCG
cYFPrev CCCTCGAG TTACTTGTACAGCTCGTCCATG