Skip to main content

Table 1 Primer and probe sequences used for quantitative real-time PCR for determining copy number of the luciferase gene.

From: High-throughput Agrobacterium-mediated barley transformation

  Luciferase   Barley CONSTANS-like CO2 genea  
Primers LucF1 CCGCCTGAAGTCTCTGATTAAGTAC HvCon2F1 TGCTAACCGTGTGGCATCAC
  LucR1 GACACCTGCGTCGAAGATGTT HvCon2R1 GGTACATAGTGCTGCTGCATCTG
Probes LucP 6FAM-AGGCTATCAGGTGGCTCCCGCTG-TAMRA HvCon2P VIC-CATGAGCGTGTGCGTGTCTGCG-TAMRA
  1. aThe barley CONSTANS-like CO2 gene was used as an internal positive control.