Skip to main content

Table 1 Selected reference genes for rice and corresponding primer pair information.

From: A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors

Locus identifier Gene name Primer sequence F/R [5'-3'] Amplicon length [bp] Amplicon Tm [°C] PCR efficiency
Os03g50890 Actin CTCCCCCATGCTATCCTTCG
TGAATGAGTAACCACGCTCCG[S]
91 81 1.9
Os05g36290* Actin1 ATCCTTGTATGCTAGCGGTCGA
ATCCAACCGGAGGATAGCATG[D]
118 80 1.9
Os01g59150* β-Tubulin GGAGTCACATGCTGCCTAAGGTT
TCACTGCCAGCTTACGGAGG[S]
64 80 1.96
Os06g11070 Expressed protein AGGCTGGTCGAGGAGTCCAT
TTCTCCTCCCTAGCGAACACCT[D]
101 85 1.83
Os03g55270 TIP41-like GTTTGGATGAACCCCGCAA
GGCAACAAGGTCAATCCGATC[S]
62 77.5 1.81
Os08g19610 Cyclophilin CCACCATCACAGATCGGATCTT
GCGGTCAGAGCGAAAGTAGCTA[S]
65 84.2 1.73
Os03g08020* Elongation factor 1α GTCATTGGCCACGTCGACTC
TGTTCATCTCAGCGGCTTCC[S]
118 83.5 1.85
  1. * Primer pair recognizes all splicing variants. Location of forward and reverse primer in the same exon [S] or in different exons [D].