Skip to main content

Advertisement

Table 3 PCR primers for amplification of COSII markers previously mapped to tomato (S. lycopersicum) chromosome XI.

From: Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

COSII marker Primer (5'–3')  
  Forward Reverse
C2_At5g09880 AGGGTCAAGCATATCCATGTGGAC TCTCTTGTGCATGGCTTGTTGAGCa
C2_At5g04590 ATCACCACAGTCCTTGCACAGGG AGGACAAAGTGGAAAAGCTGGGa
C2_At3g54470 TCCTGACTTTGGTTCTAAGCTTAGATCGa TCAAATATTAAGAAGTTGTGCTTGTCTGC
  1. aPrimers that were also used in combination with the respective AS SPD primer for SNP genotyping (see text; SNP genotyping). Primer source: SOL Genomics Network [30].