Skip to main content

Table 4 Oligonucleotide sequences of 12 URP primers (Adapted from [62]).

From: Recent developments in primer design for DNA polymorphism and mRNA profiling in higher plants

Primers Sequences (5'-3')
URP1F ATCCAAGGTCCGAGACAACC
URP2F GTGTGCGATCAGTTGCTGGG
URP2R CCCAGCAACTGATCGCACAC
URP4R AGGACTCGATAACAGGCTCC
URP6R GGCAAGCTGGTGGGAGGTAC
URP9F ATGTGTGCGATCAGTTGCTG
URP13R TACATCGCAAGTGACACAGG
URP17R AATGTGGGCAAGCTGGTGGT
URP25F GATGTGTTCTTGGAGCCTGT
URP30F GGACAAGAAGAGGATGTGGA
URP32F TACACGTCTCGATCTACAGG
URP38F AAGAGGCATTCTACCACCAC