Skip to main content

Table 6 List of primers used during in situ PCR

From: Protocol: a fast and simple in situ PCR method for localising gene expression in plant tissue

Gene name Accession number Primer sequence (5′ to 3′)
Hv18S AK251731.1 qF: GGTAATTCCAGCTCCAAT
qR: GTTTATGGTTGAGACTAG
TmHKT1; 5-A DQ646339.2 qF: GACCACAAAAGGATAACAAGCA
qR: AGAACATGACAGCAATGAGAGC
GmPIP1; 2b XM_003532769.2 qF: TGTTTTTGTATGTGCTTGCTTG
qR: TCCATTCAGAGTGTCACAAATACA
AtCAX1 NM_201901.3 qF: AGTTGCGTTAGGCTCTGC
qR: TTGATGTCCCAAGTGAATG
HvSL1251 AK371960.1 qF: GGTCACAACCACGGCTATTT
qR: GTCTTGAATGAGGGCAGAGC
AtALMT14 NM_001125913.1 qF: CGGTAGACATAACCCCAACG
qR: TCAACACCACAATCCTGCTC