Skip to main content

Table 2 List of primers and T-DNA lines used

From: A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

Species/gene T-DNA knockout Primer No Primer (5'-3')
AtSOC1    GGATCGAGTCAGCACCAAACC
CTTGAAGAACAAGGTAACCCA
AtAGC1-10    CGTTTCACTATCTCCTCCACAAG
GGTGCTTTCAGAATGTTTACTAACGT
AtWRKY22 SALK_098205 2003
2004
AAGAAAGTGTGCCATGTAGCAG
CCGGAGACGATGAATAAGTAGC
AtWRKY46 GABI-Kat 038C07 182
712
ATGGAGGAGGTTCTAGCGAGAGTC
AAACGTCTTTACCATCATCAAGC
AtWRKY53 SALK_034157 713
714
ACGAATTGGAACTAGGGAAAGAG
CCATCATCAATAGAGCCATTTTC
AtWRKY36 GABI-Kat 258B10 72
136
CCTGCCTACAAAGATCATCTAGTTTCG
ATGATCAAAGAGGAGACCGTTTC
AtWRKY70 GABI-Kat 752F08   ATGGATACTAATAAAGCAAAAAAGC
AGATAGATTCGAACATGAACTGAAG
AtWRKY18 GABI-Kat 328G03   CATGGGTTCATTTCAAATTTTCG
CGATCTGCTCATGTTGCTGATGATG
NtCDPK2    ATGGGCAACGCATGCGGCGG
GATGACTCTCAAAGCCATTTTC
NtRBCS    CCTCTGCAGCAGTTGCCACC
CCTGTGGGTATGCCTTCTTC
Hordeum vulgare   28-12A ATACCTGCACAGCCACAAGTC
GCAACTTCGCCTCTACGTTC
Hordeum vulgare   29-19A ACATGTGAGCTTGCTGGTTG
TGGGGGATGGTTAATGGTAG
Hordeum vulgare   33-22A CCTGCCGATGTAATCTGGTT
GATCTTTGCCATGTCTGTTTCG
Hordeum vulgare   41-30A AACATGCAAGCACACGTCAT
CATGATTGCTGTGGCTGACT