Skip to main content

Advertisement

Table 2 List of primers and T-DNA lines used

From: A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

Species/gene T-DNA knockout Primer No Primer (5'-3')
AtSOC1    GGATCGAGTCAGCACCAAACC CTTGAAGAACAAGGTAACCCA
AtAGC1-10    CGTTTCACTATCTCCTCCACAAG GGTGCTTTCAGAATGTTTACTAACGT
AtWRKY22 SALK_098205 2003 2004 AAGAAAGTGTGCCATGTAGCAG CCGGAGACGATGAATAAGTAGC
AtWRKY46 GABI-Kat 038C07 182 712 ATGGAGGAGGTTCTAGCGAGAGTC AAACGTCTTTACCATCATCAAGC
AtWRKY53 SALK_034157 713 714 ACGAATTGGAACTAGGGAAAGAG CCATCATCAATAGAGCCATTTTC
AtWRKY36 GABI-Kat 258B10 72 136 CCTGCCTACAAAGATCATCTAGTTTCG ATGATCAAAGAGGAGACCGTTTC
AtWRKY70 GABI-Kat 752F08   ATGGATACTAATAAAGCAAAAAAGC AGATAGATTCGAACATGAACTGAAG
AtWRKY18 GABI-Kat 328G03   CATGGGTTCATTTCAAATTTTCG CGATCTGCTCATGTTGCTGATGATG
NtCDPK2    ATGGGCAACGCATGCGGCGG GATGACTCTCAAAGCCATTTTC
NtRBCS    CCTCTGCAGCAGTTGCCACC CCTGTGGGTATGCCTTCTTC
Hordeum vulgare   28-12A ATACCTGCACAGCCACAAGTC GCAACTTCGCCTCTACGTTC
Hordeum vulgare   29-19A ACATGTGAGCTTGCTGGTTG TGGGGGATGGTTAATGGTAG
Hordeum vulgare   33-22A CCTGCCGATGTAATCTGGTT GATCTTTGCCATGTCTGTTTCG
Hordeum vulgare   41-30A AACATGCAAGCACACGTCAT CATGATTGCTGTGGCTGACT