Skip to main content

Advertisement

Table 1 List of chromosomal positions of BSA markers detecting polymorphism between A. thaliana ecotypes Col-0 and Ler.

From: A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

Chr Marker Forward primer (5'-3') Reverse primer (5'-3') Col-0 (bp) Ler(bp)
I nga63 GCCTAAACCAAGGCACAGAAG TCATCAGTATTCGACCCAAG 87 99
I F3F19 CCACAAAACAATTTGGTTCACTC TCCCGTTGGGGATATTAAAG 100, 143 243
I F20D23 TTATGCCAACTCATGTGGAAAG TGTCAAAGCGTCTGGTTCTG 233 254
I F12K8 ACCAACACCACAACAAACGAC CTTTTTCTGTTCTTCCGCTATTC 171 192
I F3I6 AGATGGAAGAGGAGGAGATGG TGCATGTATATGATGAGCGAGAG 251 311
I SO392 GTTGTTGATCGCAGCTTGATAAG TTTGGAGTTAGACACGGATCTG 142 156
I F7P12 TCGAGGATATGTTTCGTGTTTG ACAGTTTTGATGCATTGTGTGAG 315 100, 215
I F1I21 TCGTAAATTGTGACTGGGAGA CCCTGTAGATCTGTTGTTTTAG 308 113, 195
I ciw1 ACATTTTCTCAATCCTTACTC GAGAGCTTCTTTATTTGTGAT 159 135
I nga280 CCTGATCTCACGGACAATAGTG GGCTCCATAAAAAGTGCACC 106 86
I F23H11 GATATGGGAGTAAGTATGAAATCGG TTCGTCCGGGTAAAAGTCAAG 300 250
I NF514a GTTGAGTCTTGGCATCACAGTTC CTGCCTGAAATTGTCGAAAC 221 240
I F20P5 GATACGTTCAAAATTAGGGACTTC TGTATTTTGCTAATTGAGGTTATGG 218 186
I AthATPase CCTGGGAACGGTTCGATTCGAG GTTCACAGAGAGACTCATAAACCA 86 70
II T20F6 CGTTCGAAACTGAATTAGCTG ACCATCTTTGTTGAGCCCTTC 297 347
II F18P14 ATTCCCGCAATTTATTTTGTTC GTTTGATGGCAGATTTGTTTTC 123 144
II ciw3 GGAAACTCAATGAAATCCACTT GTGAACTTGTTGTGAGCTTTGA 230 200
II F26B6 CTCTATCTGCCCACGAACAAG GCCATTGCAAAAGAACATCAG 233 274
II F16P2 CAGCAATCAAATAACGTGGTG CTCTCTTCTTTCTTCGCCATTAG 237 167
II F4P9 TGGTCCATACCCATTTCATAAC ATGAATTTTCATTCTACTGTTTTG 299 262
II T2H17 ATTGCATACCACGCAGTTCAC CCATTTTGCCCTTTCCTTCTAC 250 274
II AthBIO2b TGACCTCCTCTTCCATGGAG TTAACAGAAACCCAAAGCTTTC 141 209
III nga172 AGCTGCTTCCTTATAGCGTCC CCATCCGAATGCCATTGTTC 162 136
III nga162 CATGCAATTTGCATCTGAGG CTCTGTCACTCTTTTCCTCTGG 107 89
III MSA6 TTGGAGGTGCTCTTAGGTTC GGGCTTTTCACATACGCTTTC 175 225
III ciw11a GTTTTTTCTAATCCCCGAGTTGAG GAAGAAATTCCTAAAGCATTC 192 242
III N7N14 CAATACACTTTATCCAGATGCTG GGGATTTGTTGATTGAAAAAGGAC 150 143
III T6H20 CGGCTGAAACTTGGAAGGGAC AGGAAGAACGTGTGATTGTG 273 293
III ciw4 GTTCATTAAACTTGCGTGTGT TACGGTCAGATTGAGTGATTC 189 215
III K27K19 TGCTTTTGAAGAGATGGTTATTAGG CCCCATTTCACTTATCATTGG 216 198
III nga6a AGCGAATCCGAAAATAATGGAG TGGATTTCTTCCTCTCTTCAC 159 137
IV ciw5 GGTTAAAAATTAGGGTTACGA AGATTTACGTGGAAGCAAT 164 144
IV F14G16 ACAAACCGATCAGCATTCAAG GCCTTTGTCACGGATTCAAC 250 198
IV T3H13 TTTGGTGGGTCAAGAGTCAAG GCAAAAGTCATTACGGACAATAC 275 229
IV T26M18 CAATTAGCGGAGGCCACTTC GGGCAAAAGCTTCCAGTAC 330 271
IV FCALL CCACCGTCAACATCCCTAAC GCTCTTATACTTCTCAGCTCTTGTC 170 180
IV F28A21 GCATCATCATTCATCACCAAC TGTGAAGTGTTTGTCTTTGTG 198 169
IV F16G20 TGTCAACCAATCGCCTTAGTC TTAATGTCCATTATTGGAACGC 113 79
IV F26K10 AGAGAGCACGATGCCTGATAG AATGCTTCAGCGATTGAGAAC 180 205
IV F6E21 TTCTTTGTTCAAGTTCCATGTCTC CGGTGATTGTCTCAAGTGTTTG 199 225
IV F23E13 TGACCGTTGAAAGTGTTGTTG GCCCGAGAAGCCTGATAG 264 246
V MHF15 CTCCTCCTTTAATTTTCTCTCTGTG AGTTCCAGCTTTGGACTTCTTC 295 268
V nga151a ATCTCATACTGACCCATATGTTCC ATTGTACAGTCTAAAAGCGAGAG 198 170
V ciw8a TACTAGTGAAACCTTTCTCAG TTTTATGTTTTCTTCAATCAGTTAG 100 135
V nga139 AGGGTTTCGTTTCACTATCCAG TGAGAGCTACCAGATCCGATG 174 132
V T1N24 CCGATGGCATAACAAGTAGAG GGGAAAGGTACACATATACAAAAGG 383 356
V nga76 GGAGAAAATGTCACTCTCCAC AGGCATGGGAGACATTTACG 231 250
V ciw9 CAGACGTATCAAATGACAAATG GACTACTGCTCAAACTATTCGG 165 145
V MPL12 GTCCCCAAAACCAATCATAAG TCCGAGTGAGAAGAGAGTTTG 319 293
V K9P8 TTATGGGTTTCTCAGAGTTTCTCAC TTGTATGCGTTTGCTTTTTCC 284 251
V MNC17 GTACCGGATCTGTGTTGTGAAG GTGCTCAAGGAAATGGGATAG 168 187
V MQB2 CTTTGATAGTAACCTTTTTCAAACCA TGCCATTTATTTGGTCAACAC 252 231
  1. DNA oligonucleotide primer pairs are listed according to their positions from the top to the bottom of each chromosome. The size (bp) of PCR amplification products from Col-0 and Ler are depicted in the last two columns to the right. F, forward primer and R, reverse primer.